OpenBio*: aj224122-bioperl.fa

File aj224122-bioperl.fa, 3.9 KB (added by heikki, 12 years ago)

bioperl processed fasta file

Line 
1>gi|13938851|emb|AJ224122.3| Arabidopsis thaliana DAG1 gene
2AATTAAAACGCCACGCAAGGCGATTCTAGGAAATCAAAACGACACGAAATGTGGGGTGGG
3TGTTTGGGTAGGAAAGACAGTTGTCAACATCAGGGATTTGGATTGAATCAAAAAAAAAGT
4CCTTAGATTTCATAAAAGCTAATCACGCCTCAAAACTGGGGCCTATCTCTTCTTTTTTGT
5CGCTTCCTGTCGGTCCTTCTCTATTTCTTCTCCAACCCCTCATTTTTGAATATTTACATA
6ACAAACCGTTTTACTTTCTTTGGTCAAAATTAGACCCAAAATTCTATATTAGTTTAAGAT
7ATGTGGTCTGTAATTTATTGTTGTATTGATATAAAAATTAGTTATAAGCGATTATATTTT
8TATGCTCAAGTAACTGGTGTTAGTTAACTATATTCCACCACGATAACCTGATTACATAAA
9ATATGATTTTAATCATTTTAGTAAACCATATCGCACGTTGGATGATTAATTTTAACGGTT
10TAATAACACGTGATTAAATTATTTTTAGAATGATTATTTACAAACGGAAAAGCTATATGT
11GACACAATAACTCGTGCAGTATTGTTAGTTTGAAAAGTGTATTTGGTTTCTTATATTTGG
12CCTCGATTTTCAGTTTATGTGCTTTTTACAAAGTTTTATTTTCGTTATCTGTTTAACGCG
13ACATTTGTTGTATGGCTTTACCGATTTGAGAATAAAATCATATTACCTTTATGTAGCCAT
14GTGTGGTGTAATATATAATAATGGTCCTTCTACGAAAAAAGCAGATCACAATTGAAATAA
15AGGGTGAAATTTGGTGTCCCTTTTCTTCGTCGAAATAACAGAACTAAATAAAAGAAAGTG
16TTATAGTATATTACGTCCGAAGAATAATCCATATTCCTGAAATACAGTCAACATATTATA
17TATTTAGTACTTTATATAAAGTTAGGAATTAAATCATATGTTTTATCGACCATATTAAGT
18CACAACTTTATCATAAATTAATCTGTAATTAGAATTCCAAGTTCGCCACCGAATTTCGTA
19ACCTAATCTACATATAATAGATAAAATATATATATGTAGAGTAATTATGATATCTATGTA
20TGTAGTCATGGTATATGAATTTTGAAATTGGCAAGGTAACATTGACGGATCGTAACCCAA
21CAAATAATATTAATTACAAAATGGGTGGGCGGGAATAGTATACAACTCATAATTCCACTC
22ACTTTTTGTATTATTAGGATATGAAATAAGAGTAATCAACATGCATAATAAAGATGTATA
23ATTTCTTCATCTTAAAAAACATAACTACATGGTTTAATACACAATTTTACCTTTTATCAA
24AAAAGTATTTCACAATTCACTCGCAAATTACGAAATGATGGCTAGTGCTTCAACTCCAAA
25TTTCGAATATTTTAAATCACGATGTGTAGAACCTTTTATTTACTGGATACTAATCACTAG
26TTTATTGAGCCAACCAATTAGTTAAATAGAACAATCAATATTATAGCCAGATATTTTTTC
27CTTTAAAAATATTTAAAAGAGGGGCCAGAAAAGAACCAGAGAGGGAGGCCATGAGACATT
28ATTATCACTAGTCAAAAACAACAAACCCTCCTTTTGCTTTTTCATATAAATTATTATATT
29TTATTTTGCAGGTTTCTTCTCTTCTTCTTCTTCTTCTTCTTCTTCTTCCTCTTGGCTGCT
30TTCTTTCATCATCCATAAAGTGAAAGCTAACGCATAGAGAGAGCCATATCGTCCCAAAAA
31AAGCAAAAGTCCAAAAAAAAACAACTCCAAAACATTCTCTCTTAGCTCTTTACTCTTTAG
32TTTCTCTCTCTCTCTCTGCCTTTCTCTTTGTTGAAGTTCATGGATGCTACGAAGTGGACT
33CAGGTACGTAAAAAGATATCTCTCTGCTATATCTGTTTGTTTGTAGCTTCTCCCCGACTC
34TCACGCTCTCTCTCTCTCTCTCTCTCTCTTTGTGTATCTCTCTACTCACATAAATATATA
35CATGTGTGTGTATGCATGTTTATATGTATGTATGAAACCAGTAGTGGTTATACAGATAGT
36CTATATAGAGATATCAATATGATGTGTTTTAATTTAGACTTTTTATATATCCGTTTGAAA
37CTTCCGAAGTTCTCGAATGGAGTTAAGGAAGTTTTGTTCTCTACAAGTTCAATTTTTCTT
38GTCATTAATTATAAAACTCTGATAACTAATGGATAAAAAAGGTATGCTTTGTTAGTTACC
39TTTTGTTCTTGGTGCTCAGGTCTTACCATTTTTTTCCTAAATTTTAATTAGTCTCCTTTC
40TTTAATTAATTTTATGTTAACGCACTGACGATTTAACGTTAACAAAAAAACCTAGATTCT
41TTTTCTTTTCAATAGAGCATAATTATTACTTCAATTTCATTTATCTCACACTAAACCCTA
42ATCTTGGCGAAATTCCTTTTATATATATAAATTTAATTAATTTTTCCACAATCTTGGCGG
43AATTCAGGACTCGGTTTTGCTTGTTATTGTTCTCTCTTTTAATTTGACATGGTTAGGGAA
44TACTTAAAGTATGTCTTAATTTTATAGGGTTTTCAAGAAATGATAAACGTAAAGCCAATG
45GAGCAAATGATTTCTAGCACCAACAACAACACACCGCAACAACAACCAACATTCATCGCC
46ACCAACACAAGGCCAAACGCCACCGCATCCAATGGTGGCTCCGGAGGAAATACCAACAAC
47ACGGCTACGATGGAAACTAGAAAGGCGAGGCCACAAGAGAAAGTAAATTGTCCAAGATGC
48AACTCAACAAACACAAAGTTCTGTTATTACAACAACTACAGTCTCACGCAACCAAGATAC
49TTCTGCAAAGGTTGTCGAAGGTATTGGACCGAAGGTGGCTCTCTTCGTAACGTCCCAGTC
50GGAGGTAGCTCAAGAAAGAACAAGAGATCCTCTACACCTTTAGCTTCACCTTCTAATCCC
51AAACTTCCAGATCTAAACCCACCGATTCTTTTCTCAAGCCAAATCCCTAATAAGTCAAAT
52AAAGATCTCAACTTGCTATCTTTCCCGGTCATGCAAGATCATCATCATCATGGTATGTCT
53CATTTTTTTCATATGCCCAAGATAGAGAACAACAATACTTCATCCTCAATCTATGCTTCA
54TCATCTCCTGTCTCAGCTCTTGAGCTTCTAAGATCCAATGGAGTCTCTTCAAGAGGCATG
55AACACGTTCTTGCCTGGTCAAATGATGGATTCAAACTCAGTCCTGTACTCATCTTTAGGG
56TTTCCAACAATGCCTGATTACAAACAGAGTAATAACAACCTTTCATTCTCCATTGATCAT
57CATCAAGGGATTGGACATAACACCATCAACAGTAACCAAAGAGCTCAAGATAACAATGAT
58GACATGAATGGAGCAAGTAGGGTTTTGTTCCCTTTTTCAGACATGAAAGAGCTTTCAAGC
59ACAACCCAAGAGAAGAGTCATGGTAATAATACATATTGGAATGGGATGTTCAGTAATACA
60GGAGGATCTTCATGGTGAAAAAAGGTTAAAAAGAGCTCATGAACTATCAGCTTTCTTCTC
61TTTTTCTGTTTTTTTCTCCTATTTTATTATAGTTTTTACTTTGATGATCTTTTGTTTTTT
62CTCACATGGGGAACTTTACTTAAAGTTGTCAGAACTTAGTTTACAGATTGTCTTTTTATT
63CCTTCTTTCTGGTTTTCCTTTTTTCCTTTTTTTATCAGTCTTTTTAAAATATGTATTTCA
64TAATTGGGTTTGATCATTCATATTTATTAGTATCAAAATAGAGTCTATGTTCATGAGGGA
65GTGTTAAGGGGTGTGAGGGTAGAAGAATAAGTGAATACGGGGGCCCG