OpenBio*: aj224122.EMBL.xml

File aj224122.EMBL.xml, 14.9 KB (added by markjschreiber, 11 years ago)

EMBLxml format

1<?xml version="1.0" encoding="UTF-8" ?>
3    xmlns:ebi=""
4    xmlns:xsi=""
5    xsi:noNamespaceSchemaLocation=""
7    <entry accession="AJ224122" version="6" dataClass="STD" taxonomicDivision="PLN" created="1998-02-27" lastUpdated="2006-11-14" releaseCreated="54" releaseLastUpdated="89">
8        <description>Arabidopsis thaliana DAG1 gene</description>
9        <keyword>BBFa gene</keyword>
10        <keyword>transcription factor</keyword>
11        <reference>
12            <citation id="1" type="submission" date="1998-02-24">
13                <author>Vittorioso P.</author>
14                <locator>Vittorioso P., Dip. Genetica e Biologia Molecolare, Universita di Roma La Sapienza, P.le Aldo Moro, 5; , 00185 Rome, ITALY.</locator>
15            <comment>revised by [3]</comment>
16            </citation>
17        </reference>
18        <reference>
19            <citation id="2" type="journal article" name="Plant J." volume="10" issue="2" first="215" last="223" year="1996">
20                <dbreference db="PUBMED" primary="8771779" />
21                <title>A rolB regulatory factor belongs to a new class of single zinc finger
22                plant proteins</title>
23                <author>De Paolis A.</author>
24                <author>Sabatini S.</author>
25                <author>De Pascalis L.</author>
26                <author>Costantino P.</author>
27                <author>Capone I.</author>
28            </citation>
29        </reference>
30        <reference>
31            <citation id="3" type="submission" date="1999-02-25">
32                <author>Vittorioso P.</author>
33                <locator>Vittorioso P., Dip. Genetica e Biologia Molecolare, Universita di Roma La Sapienza, P.le Aldo Moro, 5; , 00185 Rome, ITALY.</locator>
34            <comment>revised by [4]</comment>
35            </citation>
36        </reference>
37        <reference>
38            <citation id="4" type="submission" date="2001-04-12">
39                <author>Vittorioso P.</author>
40                <locator>Vittorioso P., Dip. Genetica e Biologia Molecolare, Universita di Roma La Sapienza, P.le Aldo Moro, 5; , 00185 Rome, ITALY.</locator>
41            </citation>
42            <citationLocation begin="1" end="3827" />
43        </reference>
44        <reference>
45            <citation id="5" type="journal article" name="Genes Dev." volume="14" issue="1" first="28" last="33" year="2000">
46                <dbreference db="PUBMED" primary="10640273" />
47                <title>Identification and disruption of an Arabidopsis zinc finger gene
48                controlling seed germination</title>
49                <author>Papi M.</author>
50                <author>Sabatini S.</author>
51                <author>Bouchez D.</author>
52                <author>Camilleri C.</author>
53                <author>Costantino P.</author>
54                <author>Vittorioso P.</author>
55            </citation>
56        </reference>
57        <feature name="source">
58            <organism>
59                <scientificName>Arabidopsis thaliana</scientificName>
60                <preferredCommonName>thale cress</preferredCommonName>
61                <taxId>3702</taxId>
62                <lineage>
63                    <taxon>Eukaryota</taxon>
64                    <taxon>Viridiplantae</taxon>
65                    <taxon>Streptophyta</taxon>
66                    <taxon>Embryophyta</taxon>
67                    <taxon>Tracheophyta</taxon>
68                    <taxon>Spermatophyta</taxon>
69                    <taxon>Magnoliophyta</taxon>
70                    <taxon>eudicotyledons</taxon>
71                    <taxon>core eudicotyledons</taxon>
72                    <taxon>rosids</taxon>
73                    <taxon>eurosids II</taxon>
74                    <taxon>Brassicales</taxon>
75                    <taxon>Brassicaceae</taxon>
76                    <taxon>Arabidopsis</taxon>
77                </lineage>
78            </organism>
79            <qualifier name="chromosome">
80                <value>3</value>
81            </qualifier>
82            <qualifier name="cultivar">
83                <value>Wassilewskija</value>
84            </qualifier>
85            <qualifier name="mol_type">
86                <value>genomic DNA</value>
87            </qualifier>
88            <location type="single" complement="false">
89                <locationElement type="range" accession="AJ224122" version="3" complement="false">
90                    <basePosition type="simple">1</basePosition>
91                    <basePosition type="simple">3827</basePosition>
92                </locationElement>
93            </location>
94        </feature>
95        <feature name="mRNA">
96            <qualifier name="gene">
97                <value>DAG1</value>
98            </qualifier>
99            <qualifier name="product">
100                <value>DNA-binding protein</value>
101            </qualifier>
102            <qualifier name="function">
103                <value>transcription factor</value>
104            </qualifier>
105            <qualifier name="experiment">
106                <value>experimental evidence, no additional details recorded</value>
107            </qualifier>
108            <location type="join" complement="false">
109                <locationElement type="range" accession="AJ224122" version="3" complement="false">
110                    <basePosition type="simple">1726</basePosition>
111                    <basePosition type="simple">1863</basePosition>
112                </locationElement>
113                <locationElement type="range" accession="AJ224122" version="3" complement="false">
114                    <basePosition type="simple">2548</basePosition>
115                    <basePosition type="simple">3052</basePosition>
116                </locationElement>
117                <locationElement type="range" accession="AJ224122" version="3" complement="false">
118                    <basePosition type="simple">3137</basePosition>
119                    <basePosition type="simple">3827</basePosition>
120                </locationElement>
121            </location>
122        </feature>
123        <feature name="CDS">
124            <dbreference db="GOA" primary="Q43385" />
125            <dbreference db="InterPro" primary="IPR003851" />
126            <dbreference db="UniProtKB/Swiss-Prot" primary="Q43385" />
127            <qualifier name="gene">
128                <value>DAG1</value>
129            </qualifier>
130            <qualifier name="standard_name">
131                <value>BBFa</value>
132            </qualifier>
133            <qualifier name="product">
134                <value>DNA-binding protein</value>
135            </qualifier>
136            <qualifier name="function">
137                <value>transcription factor</value>
138            </qualifier>
139            <qualifier name="experiment">
140                <value>experimental evidence, no additional details recorded</value>
141            </qualifier>
142            <qualifier name="protein_id">
143                <value>CAB40190.1</value>
144            </qualifier>
145            <qualifier name="translation">
147            </qualifier>
148            <location type="join" complement="false">
149                <locationElement type="range" accession="AJ224122" version="3" complement="false">
150                    <basePosition type="simple">1840</basePosition>
151                    <basePosition type="simple">1863</basePosition>
152                </locationElement>
153                <locationElement type="range" accession="AJ224122" version="3" complement="false">
154                    <basePosition type="simple">2548</basePosition>
155                    <basePosition type="simple">3052</basePosition>
156                </locationElement>
157                <locationElement type="range" accession="AJ224122" version="3" complement="false">
158                    <basePosition type="simple">3137</basePosition>
159                    <basePosition type="simple">3498</basePosition>
160                </locationElement>
161            </location>
162        </feature>
163        <feature name="exon">
164            <qualifier name="gene">
165                <value>DAG1</value>
166            </qualifier>
167            <qualifier name="number">
168                <value>1</value>
169            </qualifier>
170            <location type="single" complement="false">
171                <locationElement type="range" accession="AJ224122" version="3" complement="false">
172                    <basePosition type="simple">1726</basePosition>
173                    <basePosition type="simple">1863</basePosition>
174                </locationElement>
175            </location>
176        </feature>
177        <feature name="intron">
178            <qualifier name="gene">
179                <value>DAG1</value>
180            </qualifier>
181            <qualifier name="number">
182                <value>1</value>
183            </qualifier>
184            <location type="single" complement="false">
185                <locationElement type="range" accession="AJ224122" version="3" complement="false">
186                    <basePosition type="simple">1864</basePosition>
187                    <basePosition type="simple">2547</basePosition>
188                </locationElement>
189            </location>
190        </feature>
191        <feature name="exon">
192            <qualifier name="gene">
193                <value>DAG1</value>
194            </qualifier>
195            <qualifier name="number">
196                <value>2</value>
197            </qualifier>
198            <location type="single" complement="false">
199                <locationElement type="range" accession="AJ224122" version="3" complement="false">
200                    <basePosition type="simple">2548</basePosition>
201                    <basePosition type="simple">3052</basePosition>
202                </locationElement>
203            </location>
204        </feature>
205        <feature name="intron">
206            <qualifier name="gene">
207                <value>DAG1</value>
208            </qualifier>
209            <qualifier name="number">
210                <value>2</value>
211            </qualifier>
212            <location type="single" complement="false">
213                <locationElement type="range" accession="AJ224122" version="3" complement="false">
214                    <basePosition type="simple">3053</basePosition>
215                    <basePosition type="simple">3136</basePosition>
216                </locationElement>
217            </location>
218        </feature>
219        <feature name="exon">
220            <qualifier name="gene">
221                <value>DAG1</value>
222            </qualifier>
223            <qualifier name="number">
224                <value>3</value>
225            </qualifier>
226            <location type="single" complement="false">
227                <locationElement type="range" accession="AJ224122" version="3" complement="false">
228                    <basePosition type="simple">3137</basePosition>
229                    <basePosition type="simple">3495</basePosition>
230                </locationElement>
231            </location>
232        </feature>
233        <sequence type="genomic DNA" length="3827" topology="linear" version="3">aattaaaacgccacgcaaggcgattctaggaaatcaaaacgacacgaaatgtggggtgggtgtttgggtaggaaagacagttgtcaacatcagggatttggattgaatcaaaaaaaaagtccttagatttcataaaagctaatcacgcctcaaaactggggcctatctcttcttttttgtcgcttcctgtcggtccttctctatttcttctccaacccctcatttttgaatatttacataacaaaccgttttactttctttggtcaaaattagacccaaaattctatattagtttaagatatgtggtctgtaatttattgttgtattgatataaaaattagttataagcgattatatttttatgctcaagtaactggtgttagttaactatattccaccacgataacctgattacataaaatatgattttaatcattttagtaaaccatatcgcacgttggatgattaattttaacggtttaataacacgtgattaaattatttttagaatgattatttacaaacggaaaagctatatgtgacacaataactcgtgcagtattgttagtttgaaaagtgtatttggtttcttatatttggcctcgattttcagtttatgtgctttttacaaagttttattttcgttatctgtttaacgcgacatttgttgtatggctttaccgatttgagaataaaatcatattacctttatgtagccatgtgtggtgtaatatataataatggtccttctacgaaaaaagcagatcacaattgaaataaagggtgaaatttggtgtcccttttcttcgtcgaaataacagaactaaataaaagaaagtgttatagtatattacgtccgaagaataatccatattcctgaaatacagtcaacatattatatatttagtactttatataaagttaggaattaaatcatatgttttatcgaccatattaagtcacaactttatcataaattaatctgtaattagaattccaagttcgccaccgaatttcgtaacctaatctacatataatagataaaatatatatatgtagagtaattatgatatctatgtatgtagtcatggtatatgaattttgaaattggcaaggtaacattgacggatcgtaacccaacaaataatattaattacaaaatgggtgggcgggaatagtatacaactcataattccactcactttttgtattattaggatatgaaataagagtaatcaacatgcataataaagatgtataatttcttcatcttaaaaaacataactacatggtttaatacacaattttaccttttatcaaaaaagtatttcacaattcactcgcaaattacgaaatgatggctagtgcttcaactccaaatttcgaatattttaaatcacgatgtgtagaaccttttatttactggatactaatcactagtttattgagccaaccaattagttaaatagaacaatcaatattatagccagatattttttcctttaaaaatatttaaaagaggggccagaaaagaaccagagagggaggccatgagacattattatcactagtcaaaaacaacaaaccctccttttgctttttcatataaattattatattttattttgcaggtttcttctcttcttcttcttcttcttcttcttcttcctcttggctgctttctttcatcatccataaagtgaaagctaacgcatagagagagccatatcgtcccaaaaaaagcaaaagtccaaaaaaaaacaactccaaaacattctctcttagctctttactctttagtttctctctctctctctgcctttctctttgttgaagttcatggatgctacgaagtggactcaggtacgtaaaaagatatctctctgctatatctgtttgtttgtagcttctccccgactctcacgctctctctctctctctctctctctttgtgtatctctctactcacataaatatatacatgtgtgtgtatgcatgtttatatgtatgtatgaaaccagtagtggttatacagatagtctatatagagatatcaatatgatgtgttttaatttagactttttatatatccgtttgaaacttccgaagttctcgaatggagttaaggaagttttgttctctacaagttcaatttttcttgtcattaattataaaactctgataactaatggataaaaaaggtatgctttgttagttaccttttgttcttggtgctcaggtcttaccatttttttcctaaattttaattagtctcctttctttaattaattttatgttaacgcactgacgatttaacgttaacaaaaaaacctagattctttttcttttcaatagagcataattattacttcaatttcatttatctcacactaaaccctaatcttggcgaaattccttttatatatataaatttaattaatttttccacaatcttggcggaattcaggactcggttttgcttgttattgttctctcttttaatttgacatggttagggaatacttaaagtatgtcttaattttatagggttttcaagaaatgataaacgtaaagccaatggagcaaatgatttctagcaccaacaacaacacaccgcaacaacaaccaacattcatcgccaccaacacaaggccaaacgccaccgcatccaatggtggctccggaggaaataccaacaacacggctacgatggaaactagaaaggcgaggccacaagagaaagtaaattgtccaagatgcaactcaacaaacacaaagttctgttattacaacaactacagtctcacgcaaccaagatacttctgcaaaggttgtcgaaggtattggaccgaaggtggctctcttcgtaacgtcccagtcggaggtagctcaagaaagaacaagagatcctctacacctttagcttcaccttctaatcccaaacttccagatctaaacccaccgattcttttctcaagccaaatccctaataagtcaaataaagatctcaacttgctatctttcccggtcatgcaagatcatcatcatcatggtatgtctcatttttttcatatgcccaagatagagaacaacaatacttcatcctcaatctatgcttcatcatctcctgtctcagctcttgagcttctaagatccaatggagtctcttcaagaggcatgaacacgttcttgcctggtcaaatgatggattcaaactcagtcctgtactcatctttagggtttccaacaatgcctgattacaaacagagtaataacaacctttcattctccattgatcatcatcaagggattggacataacaccatcaacagtaaccaaagagctcaagataacaatgatgacatgaatggagcaagtagggttttgttccctttttcagacatgaaagagctttcaagcacaacccaagagaagagtcatggtaataatacatattggaatgggatgttcagtaatacaggaggatcttcatggtgaaaaaaggttaaaaagagctcatgaactatcagctttcttctctttttctgtttttttctcctattttattatagtttttactttgatgatcttttgttttttctcacatggggaactttacttaaagttgtcagaacttagtttacagattgtctttttattccttctttctggttttccttttttcctttttttatcagtctttttaaaatatgtatttcataattgggtttgatcattcatatttattagtatcaaaatagagtctatgttcatgagggagtgttaaggggtgtgagggtagaagaataagtgaatacgggggcccg</sequence>
234    </entry>