OpenBio*: aj224122.insd

File aj224122.insd, 19.5 KB (added by jan.aerts, 13 years ago)

AJ224122 in INSD format as downloaded from NCBI

1<?xml version="1.0"?>
5  <INSDSeq_locus>AJ224122</INSDSeq_locus>
6  <INSDSeq_length>3827</INSDSeq_length>
7  <INSDSeq_strandedness>double</INSDSeq_strandedness>
8  <INSDSeq_moltype>DNA</INSDSeq_moltype>
9  <INSDSeq_topology>linear</INSDSeq_topology>
10  <INSDSeq_division>PLN</INSDSeq_division>
11  <INSDSeq_update-date>14-NOV-2006</INSDSeq_update-date>
12  <INSDSeq_create-date>27-FEB-1998</INSDSeq_create-date>
13  <INSDSeq_definition>Arabidopsis thaliana DAG1 gene</INSDSeq_definition>
14  <INSDSeq_primary-accession>AJ224122</INSDSeq_primary-accession>
15  <INSDSeq_accession-version>AJ224122.3</INSDSeq_accession-version>
16  <INSDSeq_other-seqids>
17    <INSDSeqid>emb|AJ224122.3|</INSDSeqid>
18    <INSDSeqid>gi|13938851</INSDSeqid>
19  </INSDSeq_other-seqids>
20  <INSDSeq_keywords>
21    <INSDKeyword>BBFa gene</INSDKeyword>
22    <INSDKeyword>transcription factor</INSDKeyword>
23  </INSDSeq_keywords>
24  <INSDSeq_source>Arabidopsis thaliana (thale cress)</INSDSeq_source>
25  <INSDSeq_organism>Arabidopsis thaliana</INSDSeq_organism>
26  <INSDSeq_taxonomy>Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core eudicotyledons; rosids; eurosids II; Brassicales; Brassicaceae; Arabidopsis</INSDSeq_taxonomy>
27  <INSDSeq_references>
28    <INSDReference>
29      <INSDReference_reference>1</INSDReference_reference>
30      <INSDReference_authors>
31        <INSDAuthor>De Paolis,A.</INSDAuthor>
32        <INSDAuthor>Sabatini,S.</INSDAuthor>
33        <INSDAuthor>De Pascalis,L.</INSDAuthor>
34        <INSDAuthor>Costantino,P.</INSDAuthor>
35        <INSDAuthor>Capone,I.</INSDAuthor>
36      </INSDReference_authors>
37      <INSDReference_title>A rolB regulatory factor belongs to a new class of single zinc finger plant proteins</INSDReference_title>
38      <INSDReference_journal>Plant J. 10 (2), 215-223 (1996)</INSDReference_journal>
39      <INSDReference_pubmed>8771779</INSDReference_pubmed>
40    </INSDReference>
41    <INSDReference>
42      <INSDReference_reference>2</INSDReference_reference>
43      <INSDReference_authors>
44        <INSDAuthor>Papi,M.</INSDAuthor>
45        <INSDAuthor>Sabatini,S.</INSDAuthor>
46        <INSDAuthor>Bouchez,D.</INSDAuthor>
47        <INSDAuthor>Camilleri,C.</INSDAuthor>
48        <INSDAuthor>Costantino,P.</INSDAuthor>
49        <INSDAuthor>Vittorioso,P.</INSDAuthor>
50      </INSDReference_authors>
51      <INSDReference_title>Identification and disruption of an Arabidopsis zinc finger gene controlling seed germination</INSDReference_title>
52      <INSDReference_journal>Genes Dev. 14 (1), 28-33 (2000)</INSDReference_journal>
53      <INSDReference_pubmed>10640273</INSDReference_pubmed>
54    </INSDReference>
55    <INSDReference>
56      <INSDReference_reference>3</INSDReference_reference>
57      <INSDReference_authors>
58        <INSDAuthor>Vittorioso,P.</INSDAuthor>
59      </INSDReference_authors>
60      <INSDReference_title>Direct Submission</INSDReference_title>
61      <INSDReference_journal>Submitted (24-FEB-1998) Vittorioso P., Dip. Genetica e Biologia Molecolare, Universita di Roma La Sapienza, P.le Aldo Moro, 5;, 00185 Rome, ITALY</INSDReference_journal>
62      <INSDReference_remark>revised by [3]</INSDReference_remark>
63    </INSDReference>
64    <INSDReference>
65      <INSDReference_reference>4</INSDReference_reference>
66      <INSDReference_authors>
67        <INSDAuthor>Vittorioso,P.</INSDAuthor>
68      </INSDReference_authors>
69      <INSDReference_title>Direct Submission</INSDReference_title>
70      <INSDReference_journal>Submitted (25-FEB-1999) Vittorioso P., Dip. Genetica e Biologia Molecolare, Universita di Roma La Sapienza, P.le Aldo Moro, 5;, 00185 Rome, ITALY</INSDReference_journal>
71      <INSDReference_remark>revised by [4]</INSDReference_remark>
72    </INSDReference>
73    <INSDReference>
74      <INSDReference_reference>5</INSDReference_reference>
75      <INSDReference_position>1..3827</INSDReference_position>
76      <INSDReference_authors>
77        <INSDAuthor>Vittorioso,P.</INSDAuthor>
78      </INSDReference_authors>
79      <INSDReference_title>Direct Submission</INSDReference_title>
80      <INSDReference_journal>Submitted (12-APR-2001) Vittorioso P., Dip. Genetica e Biologia Molecolare, Universita di Roma La Sapienza, P.le Aldo Moro, 5;, 00185 Rome, ITALY</INSDReference_journal>
81    </INSDReference>
82  </INSDSeq_references>
83  <INSDSeq_comment>On May 3, 2001 this sequence version replaced gi:4469119.</INSDSeq_comment>
84  <INSDSeq_feature-table>
85    <INSDFeature>
86      <INSDFeature_key>source</INSDFeature_key>
87      <INSDFeature_location>1..3827</INSDFeature_location>
88      <INSDFeature_intervals>
89        <INSDInterval>
90          <INSDInterval_from>1</INSDInterval_from>
91          <INSDInterval_to>3827</INSDInterval_to>
92          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
93        </INSDInterval>
94      </INSDFeature_intervals>
95      <INSDFeature_quals>
96        <INSDQualifier>
97          <INSDQualifier_name>organism</INSDQualifier_name>
98          <INSDQualifier_value>Arabidopsis thaliana</INSDQualifier_value>
99        </INSDQualifier>
100        <INSDQualifier>
101          <INSDQualifier_name>mol_type</INSDQualifier_name>
102          <INSDQualifier_value>genomic DNA</INSDQualifier_value>
103        </INSDQualifier>
104        <INSDQualifier>
105          <INSDQualifier_name>cultivar</INSDQualifier_name>
106          <INSDQualifier_value>Wassilewskija</INSDQualifier_value>
107        </INSDQualifier>
108        <INSDQualifier>
109          <INSDQualifier_name>db_xref</INSDQualifier_name>
110          <INSDQualifier_value>taxon:3702</INSDQualifier_value>
111        </INSDQualifier>
112        <INSDQualifier>
113          <INSDQualifier_name>chromosome</INSDQualifier_name>
114          <INSDQualifier_value>3</INSDQualifier_value>
115        </INSDQualifier>
116        <INSDQualifier>
117          <INSDQualifier_name>ecotype</INSDQualifier_name>
118          <INSDQualifier_value>Wassilewskija</INSDQualifier_value>
119        </INSDQualifier>
120      </INSDFeature_quals>
121    </INSDFeature>
122    <INSDFeature>
123      <INSDFeature_key>gene</INSDFeature_key>
124      <INSDFeature_location>1726..3827</INSDFeature_location>
125      <INSDFeature_intervals>
126        <INSDInterval>
127          <INSDInterval_from>1726</INSDInterval_from>
128          <INSDInterval_to>3827</INSDInterval_to>
129          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
130        </INSDInterval>
131      </INSDFeature_intervals>
132      <INSDFeature_quals>
133        <INSDQualifier>
134          <INSDQualifier_name>gene</INSDQualifier_name>
135          <INSDQualifier_value>DAG1</INSDQualifier_value>
136        </INSDQualifier>
137      </INSDFeature_quals>
138    </INSDFeature>
139    <INSDFeature>
140      <INSDFeature_key>mRNA</INSDFeature_key>
141      <INSDFeature_location>join(1726..1863,2548..3052,3137..3827)</INSDFeature_location>
142      <INSDFeature_intervals>
143        <INSDInterval>
144          <INSDInterval_from>1726</INSDInterval_from>
145          <INSDInterval_to>1863</INSDInterval_to>
146          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
147        </INSDInterval>
148        <INSDInterval>
149          <INSDInterval_from>2548</INSDInterval_from>
150          <INSDInterval_to>3052</INSDInterval_to>
151          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
152        </INSDInterval>
153        <INSDInterval>
154          <INSDInterval_from>3137</INSDInterval_from>
155          <INSDInterval_to>3827</INSDInterval_to>
156          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
157        </INSDInterval>
158      </INSDFeature_intervals>
159      <INSDFeature_operator>join</INSDFeature_operator>
160      <INSDFeature_quals>
161        <INSDQualifier>
162          <INSDQualifier_name>gene</INSDQualifier_name>
163          <INSDQualifier_value>DAG1</INSDQualifier_value>
164        </INSDQualifier>
165        <INSDQualifier>
166          <INSDQualifier_name>product</INSDQualifier_name>
167          <INSDQualifier_value>DNA-binding protein</INSDQualifier_value>
168        </INSDQualifier>
169        <INSDQualifier>
170          <INSDQualifier_name>experiment</INSDQualifier_name>
171          <INSDQualifier_value>experimental evidence, no additional details recorded</INSDQualifier_value>
172        </INSDQualifier>
173        <INSDQualifier>
174          <INSDQualifier_name>function</INSDQualifier_name>
175          <INSDQualifier_value>transcription factor</INSDQualifier_value>
176        </INSDQualifier>
177      </INSDFeature_quals>
178    </INSDFeature>
179    <INSDFeature>
180      <INSDFeature_key>exon</INSDFeature_key>
181      <INSDFeature_location>1726..1863</INSDFeature_location>
182      <INSDFeature_intervals>
183        <INSDInterval>
184          <INSDInterval_from>1726</INSDInterval_from>
185          <INSDInterval_to>1863</INSDInterval_to>
186          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
187        </INSDInterval>
188      </INSDFeature_intervals>
189      <INSDFeature_quals>
190        <INSDQualifier>
191          <INSDQualifier_name>gene</INSDQualifier_name>
192          <INSDQualifier_value>DAG1</INSDQualifier_value>
193        </INSDQualifier>
194        <INSDQualifier>
195          <INSDQualifier_name>number</INSDQualifier_name>
196          <INSDQualifier_value>1</INSDQualifier_value>
197        </INSDQualifier>
198      </INSDFeature_quals>
199    </INSDFeature>
200    <INSDFeature>
201      <INSDFeature_key>CDS</INSDFeature_key>
202      <INSDFeature_location>join(1840..1863,2548..3052,3137..3498)</INSDFeature_location>
203      <INSDFeature_intervals>
204        <INSDInterval>
205          <INSDInterval_from>1840</INSDInterval_from>
206          <INSDInterval_to>1863</INSDInterval_to>
207          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
208        </INSDInterval>
209        <INSDInterval>
210          <INSDInterval_from>2548</INSDInterval_from>
211          <INSDInterval_to>3052</INSDInterval_to>
212          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
213        </INSDInterval>
214        <INSDInterval>
215          <INSDInterval_from>3137</INSDInterval_from>
216          <INSDInterval_to>3498</INSDInterval_to>
217          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
218        </INSDInterval>
219      </INSDFeature_intervals>
220      <INSDFeature_operator>join</INSDFeature_operator>
221      <INSDFeature_quals>
222        <INSDQualifier>
223          <INSDQualifier_name>gene</INSDQualifier_name>
224          <INSDQualifier_value>DAG1</INSDQualifier_value>
225        </INSDQualifier>
226        <INSDQualifier>
227          <INSDQualifier_name>function</INSDQualifier_name>
228          <INSDQualifier_value>transcription factor</INSDQualifier_value>
229        </INSDQualifier>
230        <INSDQualifier>
231          <INSDQualifier_name>standard_name</INSDQualifier_name>
232          <INSDQualifier_value>BBFa</INSDQualifier_value>
233        </INSDQualifier>
234        <INSDQualifier>
235          <INSDQualifier_name>experiment</INSDQualifier_name>
236          <INSDQualifier_value>experimental evidence, no additional details recorded</INSDQualifier_value>
237        </INSDQualifier>
238        <INSDQualifier>
239          <INSDQualifier_name>codon_start</INSDQualifier_name>
240          <INSDQualifier_value>1</INSDQualifier_value>
241        </INSDQualifier>
242        <INSDQualifier>
243          <INSDQualifier_name>transl_table</INSDQualifier_name>
244          <INSDQualifier_value>1</INSDQualifier_value>
245        </INSDQualifier>
246        <INSDQualifier>
247          <INSDQualifier_name>product</INSDQualifier_name>
248          <INSDQualifier_value>DNA-binding protein</INSDQualifier_value>
249        </INSDQualifier>
250        <INSDQualifier>
251          <INSDQualifier_name>protein_id</INSDQualifier_name>
252          <INSDQualifier_value>CAB40190.1</INSDQualifier_value>
253        </INSDQualifier>
254        <INSDQualifier>
255          <INSDQualifier_name>db_xref</INSDQualifier_name>
256          <INSDQualifier_value>GI:4581965</INSDQualifier_value>
257        </INSDQualifier>
258        <INSDQualifier>
259          <INSDQualifier_name>db_xref</INSDQualifier_name>
260          <INSDQualifier_value>GOA:Q43385</INSDQualifier_value>
261        </INSDQualifier>
262        <INSDQualifier>
263          <INSDQualifier_name>db_xref</INSDQualifier_name>
264          <INSDQualifier_value>InterPro:IPR003851</INSDQualifier_value>
265        </INSDQualifier>
266        <INSDQualifier>
267          <INSDQualifier_name>db_xref</INSDQualifier_name>
268          <INSDQualifier_value>UniProtKB/Swiss-Prot:Q43385</INSDQualifier_value>
269        </INSDQualifier>
270        <INSDQualifier>
271          <INSDQualifier_name>translation</INSDQualifier_name>
273        </INSDQualifier>
274      </INSDFeature_quals>
275    </INSDFeature>
276    <INSDFeature>
277      <INSDFeature_key>intron</INSDFeature_key>
278      <INSDFeature_location>1864..2547</INSDFeature_location>
279      <INSDFeature_intervals>
280        <INSDInterval>
281          <INSDInterval_from>1864</INSDInterval_from>
282          <INSDInterval_to>2547</INSDInterval_to>
283          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
284        </INSDInterval>
285      </INSDFeature_intervals>
286      <INSDFeature_quals>
287        <INSDQualifier>
288          <INSDQualifier_name>gene</INSDQualifier_name>
289          <INSDQualifier_value>DAG1</INSDQualifier_value>
290        </INSDQualifier>
291        <INSDQualifier>
292          <INSDQualifier_name>number</INSDQualifier_name>
293          <INSDQualifier_value>1</INSDQualifier_value>
294        </INSDQualifier>
295      </INSDFeature_quals>
296    </INSDFeature>
297    <INSDFeature>
298      <INSDFeature_key>exon</INSDFeature_key>
299      <INSDFeature_location>2548..3052</INSDFeature_location>
300      <INSDFeature_intervals>
301        <INSDInterval>
302          <INSDInterval_from>2548</INSDInterval_from>
303          <INSDInterval_to>3052</INSDInterval_to>
304          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
305        </INSDInterval>
306      </INSDFeature_intervals>
307      <INSDFeature_quals>
308        <INSDQualifier>
309          <INSDQualifier_name>gene</INSDQualifier_name>
310          <INSDQualifier_value>DAG1</INSDQualifier_value>
311        </INSDQualifier>
312        <INSDQualifier>
313          <INSDQualifier_name>number</INSDQualifier_name>
314          <INSDQualifier_value>2</INSDQualifier_value>
315        </INSDQualifier>
316      </INSDFeature_quals>
317    </INSDFeature>
318    <INSDFeature>
319      <INSDFeature_key>intron</INSDFeature_key>
320      <INSDFeature_location>3053..3136</INSDFeature_location>
321      <INSDFeature_intervals>
322        <INSDInterval>
323          <INSDInterval_from>3053</INSDInterval_from>
324          <INSDInterval_to>3136</INSDInterval_to>
325          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
326        </INSDInterval>
327      </INSDFeature_intervals>
328      <INSDFeature_quals>
329        <INSDQualifier>
330          <INSDQualifier_name>gene</INSDQualifier_name>
331          <INSDQualifier_value>DAG1</INSDQualifier_value>
332        </INSDQualifier>
333        <INSDQualifier>
334          <INSDQualifier_name>number</INSDQualifier_name>
335          <INSDQualifier_value>2</INSDQualifier_value>
336        </INSDQualifier>
337      </INSDFeature_quals>
338    </INSDFeature>
339    <INSDFeature>
340      <INSDFeature_key>exon</INSDFeature_key>
341      <INSDFeature_location>3137..3495</INSDFeature_location>
342      <INSDFeature_intervals>
343        <INSDInterval>
344          <INSDInterval_from>3137</INSDInterval_from>
345          <INSDInterval_to>3495</INSDInterval_to>
346          <INSDInterval_accession>AJ224122.3</INSDInterval_accession>
347        </INSDInterval>
348      </INSDFeature_intervals>
349      <INSDFeature_quals>
350        <INSDQualifier>
351          <INSDQualifier_name>gene</INSDQualifier_name>
352          <INSDQualifier_value>DAG1</INSDQualifier_value>
353        </INSDQualifier>
354        <INSDQualifier>
355          <INSDQualifier_name>number</INSDQualifier_name>
356          <INSDQualifier_value>3</INSDQualifier_value>
357        </INSDQualifier>
358      </INSDFeature_quals>
359    </INSDFeature>
360  </INSDSeq_feature-table>
361  <INSDSeq_sequence>aattaaaacgccacgcaaggcgattctaggaaatcaaaacgacacgaaatgtggggtgggtgtttgggtaggaaagacagttgtcaacatcagggatttggattgaatcaaaaaaaaagtccttagatttcataaaagctaatcacgcctcaaaactggggcctatctcttcttttttgtcgcttcctgtcggtccttctctatttcttctccaacccctcatttttgaatatttacataacaaaccgttttactttctttggtcaaaattagacccaaaattctatattagtttaagatatgtggtctgtaatttattgttgtattgatataaaaattagttataagcgattatatttttatgctcaagtaactggtgttagttaactatattccaccacgataacctgattacataaaatatgattttaatcattttagtaaaccatatcgcacgttggatgattaattttaacggtttaataacacgtgattaaattatttttagaatgattatttacaaacggaaaagctatatgtgacacaataactcgtgcagtattgttagtttgaaaagtgtatttggtttcttatatttggcctcgattttcagtttatgtgctttttacaaagttttattttcgttatctgtttaacgcgacatttgttgtatggctttaccgatttgagaataaaatcatattacctttatgtagccatgtgtggtgtaatatataataatggtccttctacgaaaaaagcagatcacaattgaaataaagggtgaaatttggtgtcccttttcttcgtcgaaataacagaactaaataaaagaaagtgttatagtatattacgtccgaagaataatccatattcctgaaatacagtcaacatattatatatttagtactttatataaagttaggaattaaatcatatgttttatcgaccatattaagtcacaactttatcataaattaatctgtaattagaattccaagttcgccaccgaatttcgtaacctaatctacatataatagataaaatatatatatgtagagtaattatgatatctatgtatgtagtcatggtatatgaattttgaaattggcaaggtaacattgacggatcgtaacccaacaaataatattaattacaaaatgggtgggcgggaatagtatacaactcataattccactcactttttgtattattaggatatgaaataagagtaatcaacatgcataataaagatgtataatttcttcatcttaaaaaacataactacatggtttaatacacaattttaccttttatcaaaaaagtatttcacaattcactcgcaaattacgaaatgatggctagtgcttcaactccaaatttcgaatattttaaatcacgatgtgtagaaccttttatttactggatactaatcactagtttattgagccaaccaattagttaaatagaacaatcaatattatagccagatattttttcctttaaaaatatttaaaagaggggccagaaaagaaccagagagggaggccatgagacattattatcactagtcaaaaacaacaaaccctccttttgctttttcatataaattattatattttattttgcaggtttcttctcttcttcttcttcttcttcttcttcttcctcttggctgctttctttcatcatccataaagtgaaagctaacgcatagagagagccatatcgtcccaaaaaaagcaaaagtccaaaaaaaaacaactccaaaacattctctcttagctctttactctttagtttctctctctctctctgcctttctctttgttgaagttcatggatgctacgaagtggactcaggtacgtaaaaagatatctctctgctatatctgtttgtttgtagcttctccccgactctcacgctctctctctctctctctctctctttgtgtatctctctactcacataaatatatacatgtgtgtgtatgcatgtttatatgtatgtatgaaaccagtagtggttatacagatagtctatatagagatatcaatatgatgtgttttaatttagactttttatatatccgtttgaaacttccgaagttctcgaatggagttaaggaagttttgttctctacaagttcaatttttcttgtcattaattataaaactctgataactaatggataaaaaaggtatgctttgttagttaccttttgttcttggtgctcaggtcttaccatttttttcctaaattttaattagtctcctttctttaattaattttatgttaacgcactgacgatttaacgttaacaaaaaaacctagattctttttcttttcaatagagcataattattacttcaatttcatttatctcacactaaaccctaatcttggcgaaattccttttatatatataaatttaattaatttttccacaatcttggcggaattcaggactcggttttgcttgttattgttctctcttttaatttgacatggttagggaatacttaaagtatgtcttaattttatagggttttcaagaaatgataaacgtaaagccaatggagcaaatgatttctagcaccaacaacaacacaccgcaacaacaaccaacattcatcgccaccaacacaaggccaaacgccaccgcatccaatggtggctccggaggaaataccaacaacacggctacgatggaaactagaaaggcgaggccacaagagaaagtaaattgtccaagatgcaactcaacaaacacaaagttctgttattacaacaactacagtctcacgcaaccaagatacttctgcaaaggttgtcgaaggtattggaccgaaggtggctctcttcgtaacgtcccagtcggaggtagctcaagaaagaacaagagatcctctacacctttagcttcaccttctaatcccaaacttccagatctaaacccaccgattcttttctcaagccaaatccctaataagtcaaataaagatctcaacttgctatctttcccggtcatgcaagatcatcatcatcatggtatgtctcatttttttcatatgcccaagatagagaacaacaatacttcatcctcaatctatgcttcatcatctcctgtctcagctcttgagcttctaagatccaatggagtctcttcaagaggcatgaacacgttcttgcctggtcaaatgatggattcaaactcagtcctgtactcatctttagggtttccaacaatgcctgattacaaacagagtaataacaacctttcattctccattgatcatcatcaagggattggacataacaccatcaacagtaaccaaagagctcaagataacaatgatgacatgaatggagcaagtagggttttgttccctttttcagacatgaaagagctttcaagcacaacccaagagaagagtcatggtaataatacatattggaatgggatgttcagtaatacaggaggatcttcatggtgaaaaaaggttaaaaagagctcatgaactatcagctttcttctctttttctgtttttttctcctattttattatagtttttactttgatgatcttttgttttttctcacatggggaactttacttaaagttgtcagaacttagtttacagattgtctttttattccttctttctggttttccttttttcctttttttatcagtctttttaaaatatgtatttcataattgggtttgatcattcatatttattagtatcaaaatagagtctatgttcatgagggagtgttaaggggtgtgagggtagaagaataagtgaatacgggggcccg</INSDSeq_sequence>